Skip to main content

Table 1 Primers used for PCR amplification and DNA sequencing

From: A new species of Hirudo (Annelida: Hirudinidae): historical biogeography of Eurasian medicinal leeches

Gene Primer name Primer sequence Reference
18S rDNA C 5'- CGGTAATTCCAGCTCCAATAG -3' Apakupakul et al. (1999) [4]
Y 5'-CAGACAAATCGCTCCACCAAC -3' Apakupakul et al. (1999) [4]
12S rDNA 12S-A 5'-AAACTAGGATTAGATACCCTATTAT-3' Palumbi, 1996 [44]
12S-B 5'-AAGAGCGACGGGCGATGTGT-3' Simon et al. [57]
CO1 LCO1490 5'-GGTCAACAAATCATAAAGATATTGG-3' Folmer et al. [20]